Click and drag to rotate
OXT gene, coding Oxytocin, 1A = 1mm 3d printed

DIGITAL PREVIEW
Not a Photo

White Natural Versatile Plastic
OXT gene, coding Oxytocin, 1A = 1mm 3d printed
OXT gene, coding Oxytocin, 1A = 1mm 3d printed

DIGITAL PREVIEW
Not a Photo

OXT gene, coding Oxytocin, 1A = 1mm

Print With Shapeways
Choose Your Material
$20.78
Choose your color and finish
QTY

Have a question about this product?

contact the designer
You must be logged in and verified to contact the designer.
Product Description
Ordere by a customer with his own specific wishes: The model is colored by CPK Coloring code, not by base as most of my other models. And scaling is slightly different to my Standard DNA Molecule Models.

This DNA sequence is part of the OXT gene on Chromosome 20, and is coding for the Oxytocin polypeptide / nonapeptide.
The Sequence in bases is:
TGCTACATCCAGAACTGCCCCCTGGGA
Details
What's in the box:
OXT gene, coding Oxytocin, 1A = 1mm
Dimensions:
2.31 x 2.39 x 9.6 cm
Switch to inches
0.91 x 0.94 x 3.78 inches
Switch to cm
Success Rate:
First To try.
What's this?
Rating:
Mature audiences only.
Logo

Hello.

We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.