<div id="cookie_notice" class="sw-cookie-notice sw--padding-vert-4 sw--padding-hor-1 sw-dms--box-shadow--big"> <div class="sw-dms--color-white sw-grid-flex sw-grid-flex--wrap-mob sw-grid-flex--wrap--tab"> <div class="sw-cookie-notice__text--mob sw--padding-left-8 sw--font-size-14 sw-grid-flex__cell-5-7 sw-grid-flex__cell-1-1--mob sw-grid-flex__cell-1-1--tab"> We use cookies to offer you a better browsing experience, including personalized advertising. By continuing to use the site you agree to their use. <a href="/legal/privacy-statement" target="_blank">Learn more</a> </div> <div class="sw-grid-flex__cell-2-7 sw-grid-flex__cell-1-1--mob sw-grid-flex__cell-1-1--tab"> <a class="sw-dms-button noty_close sw--padding-hor-7 sw--position-absolute sw--position-right sw--margin-right-13 sw--hide-mobile sw--hide-tablet" data-sw-set-cookie="euCookie">OK</a> <a class="sw-cookie-notice__btn--mob sw-cookie-notice__btn--tab sw-dms-button noty_close sw--padding-hor-7 sw--margin-vert-3 sw--hide-desktop" data-sw-set-cookie="euCookie">OK</a> </div> </div> </div>

<div class="sw--display-block sw-dms--color-white" style="background-color: #1e2740"> <div id="emailModalContentContainer"> <span class="noty_close sw--position-absolute sw--position-right sw--padding-top-3 sw--padding-right-3 icon-cancel sw--opacity-8 sw--z-index-10"></span> <div class="sw-row"> <div class="sw--position-relative sw--display-block sw--padding-3" style="min-width: 380px"> <p class="sw--font-size-16 sw--margin-bottom-2 sw--margin-right-6">Sign up to hear about special promotions</p> <form action="/register/email-signup" class="sw--position-relative" data-confirmation="emailConfirmationModal" data-sw-email-modal-form> <input type="text" class="sw--input-height__medium" style="width:60%;" placeholder="Email address" name="email" /> <input type="hidden" class="" name="location" value="/product/6XSSQ6UU6/dna-molecule-model-atctcattatcttggaacaaa" /> <input type="hidden" class="" name="confirmation" value="emailConfirmationModal" /> <input type="submit" class="btn-primary sw--margin-left-1" value="Subscribe" /> <div id="emailModalFormError" class="text-error" style="display:none"></div> </form> </div> </div> </div>

DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

DNA Molecule Model atctcattatcttggaacaaa

Not For Sale
Product Description
Size = Standard. 1A = 1.0mm.
Sign In or Join to comment.


We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.