<div class="sw-email-modal sw--display-block"> <div id="emailModalContentContainer"> <span class="noty_close sw--position-absolute sw--position-right sw--padding-top-3 sw--padding-right-3 icon-cancel sw--opacity-8"></span> <div class="sw-row"> <div class="sw-email-modal__copy sw--position-relative sw--display-block sw--padding-vert-4"> <p class="last sw--font-size-16">Sign up to get email alerts on discount promotions. There might be one very soon...</p> <form action="/register/email-signup" class="sw-email-modal__signup sw--position-relative" data-confirmation="emailConfirmationModal" data-sw-email-modal-form> <input type="text" class="sw-email-modal__signup-input sw--input-height__medium" placeholder="Email address" name="email" /> <input type="hidden" class="sw-email-modal__signup-input" name="location" value="/product/6XSSQ6UU6/dna-molecule-model-atctcattatcttggaacaaa" /> <input type="hidden" class="sw-email-modal__signup-input" name="confirmation" value="emailConfirmationModal" /> <input type="submit" class="btn-primary" value="Sign Up" /> <div id="emailModalFormError" class="text-error" style="display:none"></div> </form> </div> </div> </div>

DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

DNA Molecule Model atctcattatcttggaacaaa

Not For Sale
Share Link
Embed This Product

Product Description

Size = Standard. 1A = 1.0mm.
What's in the Box
DNA Molecule Model atctcattatcttggaacaaa
Picture still generating
Full Color Sandstone
2.3 cm
7.5 cm
2.4 cm
Sign In or Join to comment.


We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.