Shapeways responds to COVID-19
How can we help?

DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating
DNA Molecule Model atctcattatcttggaacaaa 3d printed Picture still generating

Not a Photo

DNA Molecule Model atctcattatcttggaacaaa

Not For Sale

Have a question about this product?

contact the designer
You must be logged in and verified to contact the designer.
Product Description
Size = Standard. 1A = 1.0mm.
Sign In or Join to comment.


We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.