You must be logged in and verified to contact the designer.
Product Description
Ordere by a customer with his own specific wishes: The model is colored by CPK Coloring code, not by base as most of my other models. And scaling is slightly different to my Standard DNA Molecule Models.
This DNA sequence is part of the OXT gene on Chromosome 20, and is coding for the Oxytocin polypeptide / nonapeptide.
The Sequence in bases is:
TGCTACATCCAGAACTGCCCCCTGGGA
We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers: