FREE SHIPPING on $25+ orders of your
uploaded designs with code MAKEITYOURS.
Details

<div class="sw-email-modal sw--display-block"> <div id="emailModalContentContainer"> <span class="noty_close sw--position-absolute sw--position-right sw--padding-top-3 sw--padding-right-3 icon-cancel sw--opacity-8"></span> <div class="sw-row"> <div class="sw-email-modal__copy sw--position-relative sw--display-block sw--padding-vert-4"> <p class="last sw--font-size-16">Sign up to get email alerts on discount promotions. There might be one very soon...</p> <form action="/register/email-signup" class="sw-email-modal__signup sw--position-relative" data-confirmation="emailConfirmationModal" data-sw-email-modal-form> <input type="text" class="sw-email-modal__signup-input sw--input-height__medium" placeholder="Email address" name="email" /> <input type="hidden" class="sw-email-modal__signup-input" name="location" value="/product/JLHLPDXMP/beta-endorphin" /> <input type="hidden" class="sw-email-modal__signup-input" name="confirmation" value="emailConfirmationModal" /> <input type="submit" class="btn-primary" value="Sign Up" /> <div id="emailModalFormError" class="text-error" style="display:none"></div> </form> </div> </div> </div>

Click and drag to rotate
Beta-endorphin 3d printed

DIGITAL PREVIEW
Not a Photo

Metallic Plastic
Beta-endorphin 3d printed
Beta-endorphin 3d printed

DIGITAL PREVIEW
Not a Photo

Beta-endorphin

Made By
OVERVIEW
  • 3D printed in Metallic Plastic: Grey nylon plastic with a subtle metallic sparkle (formerly Alumide.)
  • Be the first to try. Learn more
  • This product is intended for mature audiences.
$11.00
1
0
Share Link
Embed This Product

Product Description

YGGFMTSEKSQTPLVTLFKNAIIKNAYKKGE
coded by the final part of the POMC gene on chromosome 2:
TACGGCGGTTTCATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAGAACGCCTACAAGAAGGGCGAG

This is a straight helix, so without the bend seen in Figure 1 of this article.

What's in the Box
INCM
β-Endorphin
Metallic Plastic
Width
5.5 cm
Height
1.6 cm
Depth
1.8 cm

Sign In or Join to comment.
 
 
Logo

Hello.

We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.