FREE SHIPPING on orders over $25! Sale ends in days. Details

<div class="sw-email-modal sw--display-block"> <div id="emailModalContentContainer"> <span class="noty_close sw--position-absolute sw--position-right sw--padding-top-3 sw--padding-right-3 icon-cancel sw--opacity-8"></span> <div class="sw-row"> <div class="sw-email-modal__copy sw--position-relative sw--display-block sw--padding-vert-4"> <p class="last sw--font-size-16">Sign up to get email alerts on discount promotions. There might be one very soon...</p> <form action="/register/email-signup" class="sw-email-modal__signup sw--position-relative" data-confirmation="emailConfirmationModal" data-sw-email-modal-form> <input type="text" class="sw-email-modal__signup-input sw--input-height__medium" placeholder="Email address" name="email" /> <input type="hidden" class="sw-email-modal__signup-input" name="location" value="/product/DT5KYG3S2/dna-molecule-model-customized-2-sequences" /> <input type="hidden" class="sw-email-modal__signup-input" name="confirmation" value="emailConfirmationModal" /> <input type="submit" class="btn-primary" value="Sign Up" /> <div id="emailModalFormError" class="text-error" style="display:none"></div> </form> </div> </div> </div>

Click and drag to rotate
DNA Molecule Model Customized, 2 sequences 3d printed

Not a Photo

Full Color Sandstone
DNA Molecule Model Customized, 2 sequences 3d printed
DNA Molecule Model Customized, 2 sequences 3d printed

Not a Photo

DNA Molecule Model Customized, 2 sequences

  • 3D printed in Full Color Sandstone: Fully colored material with a coarse finish and a delicate feel.
  • Be the first to try. Learn more
  • This product is intended for mature audiences.
Share Link
Embed This Product

Product Description

For more info on customized DNA models such as these, check out my shop 3D DNA Molecule Models at

These two models encode DNA sequences ATCAACAGCACCATCACCGTGACCGAG and TGGCACATCACCGAGCACGAGGCCGAC, as requested by customer.

These models are according to regular option "Large, Horizontal".

When ordering two models at once like this I can give a reduction of $10,= on the order.

What's in the Box
Full Color Sandstone
6.9 cm
3.5 cm
14.3 cm

Sign In or Join to comment.


We're sorry to inform you that we no longer support this browser and can't confirm that everything will work as expected. For the best Shapeways experience, please use one of the following browsers:

Click anywhere outside this window to continue.